LCB2/YDR062W Locus History Help


Nomenclature History
Standard Name Reference
LCB2 Nagiec MM, et al.  (1994) The LCB2 gene of Saccharomyces and the related LCB1 gene encode subunits of serine palmitoyltransferase, the initial enzyme in sphingolipid synthesis. Proc Natl Acad Sci U S A 91(17):7899-902
Other Name(s)Reference
SCS1 Zhao C, et al.  (1994) Suppressors of the Ca(2+)-sensitive yeast mutant (csg2) identify genes involved in sphingolipid biosynthesis. Cloning and characterization of SCS1, a gene required for serine palmitoyltransferase activity. J Biol Chem 269(34):21480-8
Nomenclature History Notes
DateNote
2001-04-03The alias SCS1 has been used to describe both LCB2/YDR062W, a serine C-palmitoyltransferase involved in sphingolipid biosynthesis, and INO2/YDR123C, a transcription factor involved in phospholipid synthesis. These two loci should not be confused.
2003-12-09SCS1 has been used in the literature to refer to both RTS1/YOR014W, which encodes a protein phosphatase 2A and LCB2/YDR062W, which encodes a serine C-palmitoyltransferase.
2003-12-09SCS1 has been used to describe both INO2/YDR123C, a transcription factor involved in phospholipid synthesis, and LCB2/YDR062W, a serine C-palmitoyltransferase involved in sphingolipid biosynthesis.
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide deletion was made in the intergenic region between ORFs LCB2/YDR062W and AIM7/YDR063W.
New    578215   AAACACGCAACGTCTTTTT-GACATAAACTTAAAACTGCCAAAAGTCAAACAAAAATTGC  578273
                ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Old    578213   AAACACGCAACGTCTTTTTTGACATAAACTTAAAACTGCCAAAAGTCAAACAAAAATTGC  578272
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
Mapping Notes
DateNote
1996-09-21Edition 13: In zhao__1994_aajfm, it was shown that SCS1 is required for serine palmitoyltransferase activity, and the authors may have stated that SCS1 is the same locus as LCB2

Cherry JM, et al.  (1996) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 13)". Pp. 361-364 in 1996 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America