YDR015C Feature History Help

Sequence Annotation Notes
DateNote
2006-04-13Due to the correction of a sequence error, the stop site of YDR015C was moved 150 nt upstream, making the predicted protein 79 amino acids rather than 129 aa. The old coordinates for YDR015C were 478195-477806, but are now 478196-477957.

Tsubouchi H and Roeder GS  (2006) Budding yeast Hed1 down-regulates the mitotic recombination machinery when meiotic recombination is impaired. Genes Dev 20(13):1766-75
2006-04-13A sequence error in the SGD sequence has been corrected: a single C was inserted in between the G at chromosomal coordinate 478023 and the C at 478024 on chromosome IV (what was three Cs is now 4 Cs). This makes the ORF of YDR015C shorter (79 amino acids) than what was originally annotated (129 aa).
New:    181 AAACAACAACTTCGTGCCAAAAATCTGTCTGAGAACACAGGTGGCGGAAGCCCCAATGGG 240
            |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Old: 477974 AAACAACAACTTCGTGCCAAAAATCTGTCTGAGAACACAGGTGGCGGAAG-CCCAATGGG 478032
Tsubouchi H and Roeder GS  (2006) Budding yeast Hed1 down-regulates the mitotic recombination machinery when meiotic recombination is impaired. Genes Dev 20(13):1766-75