RGT2/YDL138W Locus History Help


Nomenclature History
Standard Name Reference
RGT2 Ozcan S, et al.  (1996) Two glucose transporters in Saccharomyces cerevisiae are glucose sensors that generate a signal for induction of gene expression. Proc Natl Acad Sci U S A 93(22):12428-32
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide insertion was made in the intergenic region between ORFs RGT2/YDL138W and ARF2/YDL137W.
New    215950   CGATCTTGCACCTCCACGTACTCCTTTTGAATAGTACACATATACCCTTACAGGAGATCG  216009
                |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Old    215951   CGATCTTGCACCTCCACGTACTCCTTTTGAATAGTACACATATACC-TTACAGGAGATCG  216009
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()