YDL034W Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution was made in the intergenic region between ORFs YDL034W and SLM3/YDL033C.
New    392578   GGTTCAATTAGGCAAGTATGTTGCTAAGATTAATTGCTGCGGCGCATCGTATAAGGTGAT  392637
                |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Old    392576   GGTTCAATTAGGCAAGTATGTTGCTAAGATTAATTGCTGCAGCGCATCGTATAAGGTGAT  392635
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()