HSP30/YCR021C Locus History Help


Nomenclature History
Standard Name Reference
HSP30 Panaretou B and Piper PW  (1992) The plasma membrane of yeast acquires a novel heat-shock protein (hsp30) and displays a decline in proton-pumping ATPase levels in response to both heat shock and the entry to stationary phase. Eur J Biochem 206(3):635-40
Sequence Annotation Notes
DateNote
2000-09-13The systematic sequence was updated in the intergenic region between features YCR020W-B and YCR021C. Note that coordinates listed are chromosomal coordinates.
Old:   155661 ATTATTGAGTTTGTGTATATAATTTATTTTGCATATTTCATAAAGAAATTAAAATTAGAT 155720
              ||| |   ||||||  ||||||||||||||||||||||||||||||||||||||||||||
New:   155950 ATTGT---GTTTGT--ATATAATTTATTTTGCATATTTCATAAAGAAATTAAAATTAGAT 156004
2011-02-03A dinucleotide insertion was made in the intergenic region between ORFs YCR020W-B and YCR021C.
New  155941  ATTAGATTATTAATTATTGTGTTTGTGTATATAATTTATTTTGCATATTTCATAAAGAAA  156000
             |||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||
Old  155939  ATTAGATTATTAATTATTGTGTT--TGTATATAATTTATTTTGCATATTTCATAAAGAAA  155996
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()