YCLWomega2 Feature History Help

Sequence Annotation Notes
DateNote
2000-09-13A single nucleotide substitution was made in the systematic sequence in the intergenic region between features YCL074W and YCLWomega2. The C at 3858 was changed to A. Note that coordinates listed are chromosomal coordinates.
Old:    3833 CATCCTGTATTTCACACGAGAGCAACACACATTGCTTTGAGATACCACAAGCTAAGAAAT 3892
             ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
New:    3841 CATCCTGTATTTCACACGAGAGCAAAACACATTGCTTTGAGATACCACAAGCTAAGAAAT 3900
2000-09-13Several sequence changes were made in the systematic sequence in the intergenic region between features YCLWomega2 and YCL073C. Note that coordinates listed are chromosomal coordinates.
Old:    5393 CAACAATCCTAGGAGTTCCAGCTCAATCGGGTATGATATCATCTCTGATACCCCCAAAATACATGGCTGTACCATT 5468
             | ||| || |    | |||||||||||||||||||||||    | ||||| ||||||||||||||||||||||||
New:    5401 CGACA-TC-T----G-TCCAGCTCAATCGGGTATGATAT----T-TGATATCCCCAAAATACATGGCTGTACCATG 5464
Old:    5469 TAAAATAAGTGGTATATTGAAGAACAGTATATTTCAGCCTATACAGGATCCTACTCTTTC 5528
             |||||| || ||||||| ||||| ||||||||||||||||||||||||||||||| ||||
New:    5465 TAAAATGAGCGGTATATCGAAGATCAGTATATTTCAGCCTATACAGGATCCTACTATTTC 5524
Old:    5589 GTTAGTAACATCAATATATCGCGGAGGTAGCTATCATTGTGGTAGCTAATTTAAAGGATA 5648
             |||||||||||||||||||||||||| ||||||||||||||| || ||| ||||||||||
New:    5585 GTTAGTAACATCAATATATCGCGGAG-TAGCTATCATTGTGGCAGTTAACTTAAAGGATA 5643
Old:    5649 TACAGTTAATTCAACAAGATTTTCAAGTCCATTTCTTTTGGGCACGCTGAACACGCTCAA 5708
             |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
New:    5644 TACAGTTAATTCAACAAGATTTTCAAGTCCATTTTTTTTGGGCACGCTGAACACGCTCAA 5703
Old:    5829 AGACCGTTGCCGACTCCAAGAAAACTATGATCTCAATACAGGCATAAAGAATTGTTGTAT 5888
             |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:    5824 AGACTGTTGCCGACTCCAAGAAAACTATGATCTCAATACAGGCATAAAGAATTGTTGTAT 5883
Old:    5889 CTGTGCCCATGTGATCTGTATCTTTTTTGCGGTACCAAAATCGCATGTTGCACTCACACT 5948
             |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
New:    5884 CTGTGCCCATGTGATCTGTACCTTTTTTGCGGTACCAAAATCGCATGTTGCACTCACACT 5943
2000-09-13Several sequence changes were made in the systematic sequence in the intergenic region between features YCLWomega2 and YCL073C. Note that coordinates listed are chromosomal coordinates.
Old:    5949 ACGGAACACATCAACTTGTAACGACAACAATGCAAAATACCGGGAGACATATCACTTCTT 6008
             ||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||
New:    5944 ACGGAACACATCAACTTGTAACGACAACAATACAAAATACCAGGAGACATATCACTTTTT 6003
Old:    6009 TTCGCTTAGAATGATTTACAATGGCATACACTTAGAAAAGTGCTATCACATGACGCCCTT 6068
             ||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||
New:    6004 TTCGCCTAGAATGATTTACAATGGCATACACTTAGAAAAGTGCTATGACATGACGCCCTT 6063
Old:    6069 ACTAGAAGTTACATGATTCTCTTTTTTTTCCTTTCTTTCTTTCTTTTTCGGTACAACATA 6128
             ||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||
New:    6064 ACTAGAAGTTACATGATTCTCCTTTTTTTTCTTTCTTTCTTTCTTTTTCGGTACAACATA 6123
Old:    6129 ATTAATGCATTCATACAGAGCGCATTTCCAGCATCTTTTATTGGATAGTAACTCCTCCCG 6188
             ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
New:    6124 ATTAATGCATTCATACAGAGCGCATTTCCAGCATCATTTATTGGATAGTAACTCCTCCCG 6183
Old:    6189 CACTTTTAATATCAATGACGCTGACTCTTTTACTGACACTGATTCTTTACCGACGCTGAG 6248
             |||||| |||||||||||||||||||||||||||||| |||| |||||||||||||||||
New:    6184 CACTTTCAATATCAATGACGCTGACTCTTTTACTGACGCTGAGTCTTTACCGACGCTGAG 6243
2000-09-13Several sequence changes were made in the systematic sequence in the intergenic region between features YCLWomega2 and YCL073C. Note that coordinates listed are chromosomal coordinates.
Old:    6249 -----------------TCTTTAGTG 6257
                              ||||||  |
New:    6244 TCTTTACCGACGCTGAGTCTTTACCG 6269
Old:    6258 ACGTTGAGTTTTTACCGACGCCTTTGAAAATAAAAAGTACGACACAGCTATATGCGTAGC 6317
             ||| ||||| ||||||||||| | ||||||||||||||||||||||||||||||||| ||
New:    6270 ACGCTGAGTCTTTACCGACGCTTGTGAAAATAAAAAGTACGACACAGCTATATGCGTCGC 6329
Old:    6318 AAGTTCAAATGTGGGTCTATCGAGCATGTTTATCCTATCCTGTTATGTCATTTTTATCGA 6377
             ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
New:    6330 AAGTTCAGATGTGGGTCTATCGAGCATGTTTATCCTATCCTGTTATGTCATTTTTATCGG 6389
Old:    6378 AAGTAATAAAAATATAGAAACCACTTGTTTTTGCCTTTTTTGTGATTTTGCTTTCTTTTT 6437
             ||||||||||| | |||||| |||||||||||||||||||||||||||||||||| ||||
New:    6390 AAGTAATAAAAGTGTAGAAATCACTTGTTTTTGCCTTTTTTGTGATTTTGCTTTCATTTT 6449
Old:    6438 TTTTTTTTTCCCTTTTTTCACCAGCTTGAGGATCAACATCCTGATTCCTTGTCACTTCGA 6497
             |||||    ||||||||||||||||||| ||||||||||||| ||| ||||| |||||||
New:    6450 TTTTTG---CCCTTTTTTCACCAGCTTGGGGATCAACATCCTAATTTCTTGTTACTTCGA 6506