YCLWdelta3 Feature History Help

Sequence Annotation Notes
DateNote
2000-09-13One sequence change was made in the systematic sequence in the region encompassing feature YCLWdelta3. Note that coordinates listed are chromosomal coordinates.
Old:   84314 GGAATTCTAACAATTATCAAATTG-CCGCCAGTTCCTCAAAAAGATCCATGTATAATCTT 84372
             |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
New:   84700 GGAATTCTAACAATTATCAAATTGTCCGCCAGTTCCTCAAAAAGATCCATGTATAATCTT 84759