ATG22/YCL038C Locus History Help


Nomenclature History
Standard Name Reference
ATG22 Klionsky DJ, et al.  (2003) A unified nomenclature for yeast autophagy-related genes. Dev Cell 5(4):539-45
Other Name(s)Reference
AUT4 Harding TM, et al.  (1996) Genetic and phenotypic overlap between autophagy and the cytoplasm to vacuole protein targeting pathway. J Biol Chem 271(30):17621-4
Nomenclature History Notes
DateNote
2003-09-10The standard gene name of ORF YCL038C was changed from AUT4 to ATG22, as part of the unified autophagy nomenclature agreed upon by the yeast research community. Sept. 10, 2003
Sequence Annotation Notes
DateNote
2000-09-13Three sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL038C and YCL037C. Note that coordinates listed are chromosomal coordinates.
Old:   56596 ACACTACGCATCTTTCA-TAGCTGAGGTATTTTCGTTTAGGAAAATACCGTTTTAAGGAA 56654
             ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
New:   56622 ACACTACGCATCTTTCAATAGCTGAGGTATTTTCGTTTAGGAAAATACCGTTTTAAGGAA 56681
Old:   57015 TATTTTTATATCTTAAAAAAAAAAAAAAAACAAAAAAAAAAAAACATAAATATTTGTATC 57074
             ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
New:   57042 TATTTTTATATCTTAAAAAAAAAAAAAAA-CAAAAAAAAAAAAACATAAATATTTGTATC 57100
Old:   57195 CAAAAAAAAAAAAAAAA-CAAAAAAAAAACAGCTTTGCTGGAGGATGATTAACTTTTAAT 57253
             ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
New:   57221 CAAAAAAAAAAAAAAAAACAAAAAAAAAACAGCTTTGCTGGAGGATGATTAACTTTTAAT 57280