RNQ1/YCL028W Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2000-12-11.
Standard Name Reference
RNQ1 Sondheimer N and Lindquist S  (2000) Rnq1: an epigenetic modifier of protein function in yeast. Mol Cell 5(1):163-72
Sequence Annotation Notes
DateNote
2000-09-13Several sequence changes were made in the systematic sequence in the region encompassing ORF YCL028W. Note that coordinates listed are chromosomal coordinates.
Old:   70693 ATCAGCAAGGTCAAAATCAAAGCTCCGGTGGTTCCTCCTTTGGAGCACTAGCTTCTATGG 70752
             ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
New:   70721 ATCAGCAAGGTCAAAATCAAAGCTCCGGTGGTTCCTCCTTTGGAGCACTGGCTTCTATGG 70780
Old:   70753 CAAGTTCTTTTATGCATTCCAATAATAATCAGAACTCCAACAATAGTCAACAGGGTTATA 70812
             |||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||
New:   70781 CAAGCTCTTTTATGCATTCCAATAATAATCAGAACTCCAACAATAGTCAACAGGGCTATA 70840
Old:   70993 ATCAACAAGGCCAAAACAACCAGCAGCAATACCAGCAACAAGGCCAAAACTATCAGCACC 71052
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
New:   71021 ATCAACAAGGCCAAAACAACCAGCAGCAATACCAGCAACAAGGCCAAAACTATCAGCATC 71080
Old:   71173 AGGCTAATGAGTATGGTAGACCACAACACAATGGTCAACAACAATCTAATGAGTACGGAA 71232
             |||||||||||||||||||||| ||||| ||||||||||| ||||| |||||||||||||
New:   71201 AGGCTAATGAGTATGGTAGACCGCAACAGAATGGTCAACAGCAATCCAATGAGTACGGAA 71260
Old:   71233 GACCGCAATACGGCGGAAACCAGAACTCCAATGGACAGCACGAATCCTTTAATTTTTCTG 71292
             ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
New:   71261 GACCGCAATACGGCGGAAACCAGAACTCCAATGGACAGCACGAATCCTTCAATTTTTCTG 71320
Old:   71353 TCGCCTTCTATCCCTTTGTTTACGTATTTGTTTATATATATAACTTTAT 71401
             ||||||||||||| |||||||||||||||||||||||||||||||||||
New:   71381 TCGCCTTCTATCC-TTTGTTTACGTATTTGTTTATATATATAACTTTAT 71428
2000-09-13Three sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL028W and YCL027W. Note that coordinates listed are chromosomal coordinates.
Old:   71368 TTGTTTACGTATTTGTTTATATATATAACTTTATTTTTTTT-ATT 71411
             ||||||||||||||||||||||||||||||||||||||||| |||
New:   71396 TTGTTTACGTATTTGTTTATATATATAACTTTATTTTTTTTTATT 71439
Old:   71592 ACAAACATGAAACGTCAGTAATTTGAAACAAATAACGTAATTCTCGGGATTGGTTTTATT 71651
             |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
New:   71620 ACAAACATGAAACGTCTGTAATTTGAAACAAATAACGTAATTCTCGGGATTGGTTTTATT 71679
Old:   71712 GACATCCTTTATCTTTTT-CCTTTAAGAGCAGGATATAAGCCATCAAGTTTCTGAAAATC 71770
             |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
New:   71740 GACATCCTTTATCTTTTTTCCTTTAAGAGCAGGATATAAGCCATCAAGTTTCTGAAAATC 71799