YCL020W Feature History Help

Sequence Annotation Notes
DateNote
2000-09-13Several sequence changes were made in the systematic sequence in the region encompassing overlapping features YCL019W and YCL020W. Note that coordinates listed are chromosomal coordinates.
Old:   85213 CACCACACACTTTAACATCAGATGAAAACTTTTCTACATGGGTTAAATTTTACATCAGAT 85272
             |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
New:   85600 CACCACACACTTTAACATCAGAAGAAAACTTTTCTACATGGGTTAAATTTTACATCAGAT 85659
Old:   86053 AATGACGAACTACCTGATCACCTTCTTATTGATTCAGGACGTTCGCAAACGCTTGTCAGA 86112
             |||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||
New:   86440 AATGACGAACTACCTGATCACCTTCTTATTGATTCAGGAGCTTCGCAAACGCTTGTCAGA 86499
Old:   86293 GAGCTGGCTAATCAAAATATTACAGCCTGCTTTACCAGAAACACTTTAGAAAGATCGGAT 86352
             ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
New:   86680 GAGCTGGCTAATCAAAATATTACTGCCTGCTTTACCAGAAACACTTTAGAAAGATCGGAT 86739
Other Notes
DateNote
2000-08-17Gag processing produces capsid proteins.