YBR292C Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03Several nucleotide changes were made in the intergenic region between ORFs YBR292C and YBR293W.
New    786721  TTCCAAATCAGATTTTTTTTCGCAATGCTTAAATCTAGTAAACACAAAGTACTACCGAAA  786780
               |||||||||||||||||||  |||||||||||||||||||||||| ||||||||||||||
Old    786717  TTCCAAATCAGATTTTTTTCTGCAATGCTTAAATCTAGTAAACAC-AAGTACTACCGAAA  786776
New    786761  AACACAAAGTACTACCGAAAAGCAAGGATGGAAACTATGGCAGTATTGAAGAGACTGAAA  786820
               ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    786757  AACAC-AAGTACTACCGAAAAGCAAGGATGGAAACTATGGCAGTATTGAAGAGACTGAAA  786815
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()