GRS1/YBR121C Locus History Help


Nomenclature History
Standard Name Reference
GRS1 Magrath C and Hyman LE  (1999) A mutation in GRS1, a glycyl-tRNA synthetase, affects 3'-end formation in Saccharomyces cerevisiae. Genetics 152(1):129-41
Other Name(s)Reference
glycyl-tRNA synthetase Magrath C and Hyman LE  (1999) A mutation in GRS1, a glycyl-tRNA synthetase, affects 3'-end formation in Saccharomyces cerevisiae. Genetics 152(1):129-41
Sequence Annotation Notes
DateNote
2011-02-03Nucleotide substitutions within the coding region of GRS1/YBR121C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 563-564 are now TT rather than HH.
New    481665  TTGGCGACTTCAGTAGTAACAGGAACTAAATCTTTGTGGTTAGATAAAGGAACTAAAAGA  481724
               ||||||||||||  |  |||||||||||||||||||||||||||||||||||||||||||
Old    481659  TTGGCGACTTCATGATGAACAGGAACTAAATCTTTGTGGTTAGATAAAGGAACTAAAAGA  481718
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()