ALG14/YBR070C Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2005-05-04.
Standard Name Reference
ALG14 Chantret I, et al.  (2005) Two proteins homologous to the N- and C-terminal domains of the bacterial glycosyltransferase Murg are required for the second step of dolichyl-linked oligosaccharide synthesis in Saccharomyces cerevisiae. J Biol Chem 280(10):9236-42 Gao XD, et al.  (2005) Alg14 Recruits Alg13 to the Cytoplasmic Face of the Endoplasmic Reticulum to Form a Novel Bipartite UDP-N-acetylglucosamine Transferase Required for the Second Step of N-Linked Glycosylation. J Biol Chem 280(43):36254-62
Sequence Annotation Notes
DateNote
1999-04-26Three changes were made to the systematic sequence of Chromosome II in the intergenic region between the ORFs TAT1/YBR069C and ALG14/YBR070C. A single T was inserted after the T at chromosomal coordinate 378810, the C at 378815 was deleted, and a C was inserted after the G at 378824:
Old: 378781 GCCGGCCCTGACTGACCTTTTTTGTATTTT-GGCCCGTCCCGGCG-GGCGAAGAGTGAGAC 378839
            |||||||||||||||||||||||||||||| |||| ||||||||| |||||||||||||||
New: 378781 GCCGGCCCTGACTGACCTTTTTTGTATTTTTGGCC-GTCCCGGCGCGGCGAAGAGTGAGAC 378840