YBLWdelta8 Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03A dinucleotide substitution was made in the intergenic region between ORF PDR3/YBL005W and Ty1 LTR YBLWdelta8.
New    220372  ATGACAATACTTCATATCCCTTCTTATGAAAACGCAAAGAAAATAGGGAAGCAGAGCATA  220431
               ||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||
Old    220375  ATGACAATACTTCATATCCCTTCTTATGAAAACGCAAAAGAAATAGGGAAGCAGAGCATA  220434
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()