YBLCtau1 Feature History Help

Sequence Annotation Notes
DateNote
2007-04-05YBLWtau1, a Ty4 LTR on Chromosome II, was mistakenly annotated on the wrong strand (i.e., on Watson instead of Crick). Both the orientation and the feature name have been corrected, so that the LTR now has the systematic name YBLCtau1 and is annotated on the Crick strand. The name YBLWtau1 is being retained as an alias.
2011-02-03A single nucleotide substitution was made in the intergenic region between Ty4 LTR YBLCtau1 and tRNA-Phe tF(GAA)B.
New    36299   TGTGCTTCAGTATTACATTTTTTGCCTTCAACGCCTTGATTGTTCTATTTTTGCTAATAA  36358
               |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Old    36296   TGTGCTTCAGTATTACTTTTTTTGCCTTCAACGCCTTGATTGTTCTATTTTTGCTAATAA  36355
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()