HTB2/YBL002W Locus History Help


Nomenclature History
Standard Name Reference
HTB2 Kolodrubetz D, et al.  (1982) Histone H2A subtypes associate interchangeably in vivo with histone H2B subtypes. Proc Natl Acad Sci U S A 79(24):7814-8
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide insertion was made in the intergenic region between ORFs HTB2/YBL002W and ECM15/YBL001C.
New    236992  AGGGTCTAGTCTATCAGCCTCCGAAGGGAGTTGTATAAATGTATATATATAACTTTATAA  237051
               ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Old    236995  AGGGTCTAGTCTATCAGCCTCCGAAGG-AGTTGTATAAATGTATATATATAACTTTATAA  237053
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
Mapping Notes
DateNote
1997-10-20Edition 14: There are two copies of histones H2A and H2B. The TRT1 locus consists of HTA1-HTB1 and the TRT2 locus consists of HTA2-HTB2

Cherry JM, et al.  (1997) Genetic and physical maps of Saccharomyces cerevisiae. Nature 387(6632 Suppl):67-73