YARCdelta8 Feature History Help

Sequence Annotation Notes
DateNote
1998-09-02The following changes were made to the systematic sequence of Chromosome I in the region encompassing features YARCdelta8 and YAR060C: deletion of the T at 210804, transversion of T to A at 210810, and transition of C to T at 211011.
Old: 210781 TTTCTCTTTGCTTGCATCTTTTTTCTTCCTTGCCAAAAAATAAAAGATACTCATTTTAAA 210840
            ||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||
New: 210776 TTTCTCTTTGCTTGCATCTTTTT-CTTCCATGCCAAAAAATAAAAGATACTCATTTTAAA 210834
Old: 210961 GCCCTTCTACGGCTTCTTCTAACCAATTGTTCCCCGTGAGTTGCTTTCTCCGAAAACCTT 211020
            |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
New: 210955 GCCCTTCTACGGCTTCTTCTAACCAATTGTTCCCCGTGAGTTGCTTTCTCTGAAAACCTT 211014