FLO1/YAR050W Locus History Help


Nomenclature History
Standard Name Reference
FLO1 SGD  (2007) Information without a citation in SGD ()
Sequence Annotation Notes
DateNote
1998-09-02The following sequence change was made to the systematic sequence of Chromosome I within the ORF YAR050W/FLO1: transversion of T to G at 203939.
Old: 203881 CAATTCTATCAGTAGGTGGTGCAACCGCGTTCAACTGTTGTGCTCAACAGCAACCGCCTA 203940
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
New: 203876 CAATTCTATCAGTAGGTGGTGCAACCGCGTTCAACTGTTGTGCTCAACAGCAACCGCCGA 203935
2011-02-03Two separate single nucleotide insertions were made in the intergenic region between ORFs YAR047C and FLO1/YAR050W.
New    202902  GCTCATTAATTGCCCTCACAAGAATTTGGAAGTGCGTAGAACAGGTAAAAGATTGTACTA  202961
               ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Old    202895  GCTCATTAATTGCCCTCACAAGAATTTGGAAGTGCGTAG-ACAGGTAAAAGATTGTACTA  202953
New    203322  TTCACTCTTGCTCGTTTGATGTAAGCTCTCTTCCGGGTTCTTATTTTTAATTCTTGTCAC  203381
               |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Old    203314  TTCACTCTTGCTCG-TTGATGTAAGCTCTCTTCCGGGTTCTTATTTTTAATTCTTGTCAC  203372
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()