BDH1/YAL060W Locus History Help


Nomenclature History
Standard Name Reference
BDH1 Gonzalez E, et al.  (2000) Characterization of a (2R,3R)-2,3-butanediol dehydrogenase as the Saccharomyces cerevisiae YAL060W gene product. Disruption and induction of the gene. J Biol Chem 275(46):35876-85
Other Name(s)Reference
(2R,3R)-2,3-butanediol dehydrogenase Gonzalez E, et al.  (2000) Characterization of a (2R,3R)-2,3-butanediol dehydrogenase as the Saccharomyces cerevisiae YAL060W gene product. Disruption and induction of the gene. J Biol Chem 275(46):35876-85
BDH Gonzalez E, et al.  (2000) Characterization of a (2R,3R)-2,3-butanediol dehydrogenase as the Saccharomyces cerevisiae YAL060W gene product. Disruption and induction of the gene. J Biol Chem 275(46):35876-85
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution within the coding region of BDH1/YAL060W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 322 is now Aspartic Acid rather than Alanine.
New    36106   TATGTTGTCGAAGACTTCGAAGAAGTTGTTCGTGCCATCCACAACGGAGACATCGCCATG  36165
               ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Old    36107   TATGTTGTCGAAGCCTTCGAAGAAGTTGTTCGTGCCATCCACAACGGAGACATCGCCATG  36166
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()