VPS8/YAL002W Locus History Help


Nomenclature History
Standard Name Reference
VPS8 Robinson JS, et al.  (1988) Protein sorting in Saccharomyces cerevisiae: isolation of mutants defective in the delivery and processing of multiple vacuolar hydrolases. Mol Cell Biol 8(11):4936-48 Rothman JH, et al.  (1989) Characterization of genes required for protein sorting and vacuolar function in the yeast Saccharomyces cerevisiae. EMBO J 8(7):2057-65
Other Name(s)Reference
FUN15 Clark MW, et al.  (1994) Sequencing of chromosome I of Saccharomyces cerevisiae: analysis of the 42 kbp SPO7-CENI-CDC15 region. Yeast 10(4):535-41
VPL8 Rothman JH and Stevens TH  (1986) Protein sorting in yeast: mutants defective in vacuole biogenesis mislocalize vacuolar proteins into the late secretory pathway. Cell 47(6):1041-51
VPT8 Bankaitis VA, et al.  (1986) Isolation of yeast mutants defective in protein targeting to the vacuole. Proc Natl Acad Sci U S A 83(23):9075-9
Sequence Annotation Notes
DateNote
2004-01-22Kellis et al. 2003 and Cliften et al. 2003 predicted and confirmed the insertion of a single C nucleotide after the C at chromosomal coordinate 143848. As a consequence of this sequence change, YAL002W was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 1176 to 1274 amino acids.
New: 143826 ATCTAGTTCTTCATATACGGCACCTCCCCTGAACGAAGATGGTCCTAAAGGGGTAGCTTC 143885
            ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| 
Old: 143826 ATCTAGTTCTTCATATACGGCAC-TCCCCTGAACGAAGATGGTCCTAAAGGGGTAGCTTC 143884
Kellis M, et al.  (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
Cliften P, et al.  (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6