TEL11L Feature History Help

Sequence Annotation Notes
DateNote
2003-09-09The chromosomal locations for TEL11R-TR, TEL11R-XR, TEL11R-XC, TEL11R, TEL11L-TR, TEL11L-XR, TEL11L-XC, and TEL11L were generously provided by Ed Louis and Dave Barton (University of Leicester, UK).
2011-02-03A single nucleotide deletion was made within TEL11L, specifically within X element core sequence TEL11L-XC.
New    361     CACATATACTTACCCTACCACTCTAATCCCACCA-CACATCACATGCCATACTCACCTTC  419
               |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Old    361     CACATATACTTACCCTACCACTCTAATCCCACCAACACATCACATGCCATACTCACCTTC  420
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()