TEL06R-XC Feature History Help

Sequence Annotation Notes
DateNote
2003-09-09The chromosomal locations for the following telomeric features on Chromosome VI were generously provided by Ed Louis and Dave Barton (University of Leicester, UK): TEL06L, TEL06L-XC, TEL06L-XR, TEL06L-TR, TEL06L-YP, TEL06R, TEL06R-XC, TEL06R-TR.
2003-09-26After sequence verification in AB972 (S288c derivative) by SGD, a single G nucleotide was inserted after chromosomal coordinate 270023. This change lies within TEL06R-XC, the X element core sequence of TEL06R, the right telomere of chromosome VI.
Old: 270000 TACTATTGATGGAAATGAGGACTG-GTCATGGGGCGCAATGGAGTGAAGTAATATATACT 270058
            |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
New: 270000 TACTATTGATGGAAATGAGGACTGGGTCATGGGGCGCAATGGAGTGAAGTAATATATACT 270059
Robben J, et al.  (2002) Revisiting the yeast chromosome VI DNA sequence reveals a correction merging YFL007w and YFL006w to a single ORF. Yeast 19(8):699-702