TEL03L Feature History Help

Sequence Annotation Notes
DateNote
2003-09-09The chromosomal locations for the following telomeric features were generously provided by Ed Louis and Dave Barton (University of Leicester, UK): TEL03L, TEL03L-XC, TEL03L-XR, TEL03L-TR, TEL03R, TEL03R-XC, TEL03R-XR, TEL03R-TR.
2000-09-13Several sequence changes were made in the systematic sequence in the region encompassing TEL03L. Note that coordinates listed below are chromosomal coordinates.
Old:     421 CTCTCCATTACCCTACCTCTCCACTCGTTACCCTGTCTGATTCAACCGTACCACTCCCAA 480
             |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
New:     421 CTCTCCATTACCCTACCTCTCCACTCGTTACCCTGTCTCATTCAACCGTACCACTCCCAA 480
Old:     721 ATCGGTCATACGCACACGGATGCTACAGTATATACCATCTCAAACTTACC-TACTTTCAT 779
             |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
New:     721 ATCGGTCATACGCACACGGATGCTACAGTATATACCATCTCAAACTTACCCTACTTTCAT 780
Old:     780 ATTC-A-TC-ATCACCCATCTCTCACCATCAGTACCAA-TGCACTCGCATCATTATGCAC 835
             |||| | || |||||||||||||||||||||||||||| |||||||||||||||||||||
New:     781 ATTCCACTCCATCACCCATCTCTCACCATCAGTACCAAATGCACTCGCATCATTATGCAC 840
Old:     836 GGC--TTGCCTCAGCGGTCTATACCCTGTGCCATTTACGCATAACGCCCATCATTATCCA 893
             |||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:     841 GGCACTTGCCTCAGCGGTCTATACCCTGTGCCATTTACGCATAACGCCCATCATTATCCA 900