RNA170 Locus History Help


Nomenclature History
Standard Name Reference
RNA170 Olivas WM, et al.  (1997) Analysis of the yeast genome: identification of new non-coding and small ORF-containing RNAs. Nucleic Acids Res 25(22):4619-25
Other Name(s)Reference
ETC5 Moqtaderi Z and Struhl K  (2004) Genome-wide occupancy profile of the RNA polymerase III machinery in Saccharomyces cerevisiae reveals loci with incomplete transcription complexes. Mol Cell Biol 24(10):4118-27
Nomenclature History Notes
DateNote
2010-04-20The ETC5 locus corresponds to the previously identified RNA170 gene.

Guffanti E, et al.  (2006) Nucleosome Depletion Activates Poised RNA Polymerase III at Unconventional Transcription Sites in Saccharomyces cerevisiae. J Biol Chem 281(39):29155-64
Sequence Annotation Notes
DateNote
2006-01-23The sequence published for RNA170, a Noncoding RNA, has a single nucleotide insertion relative to the reference strain, S288C. It is possible that this represents a sequencing error in the reference strain, or that it simply reflects natural sequence variation between strains. Sequence confirmation is pending at SGD. 
RNA170:     47 GCTATCGTTCTCGTTTGGATTGATTTTCAGTATGGAAGAATTTGGAT 1
               |||||||||||||||||||| ||||||||||||||||||||||||||
 S288C: 667380 GCTATCGTTCTCGTTTGGAT-GATTTTCAGTATGGAAGAATTTGGAT 667425
Olivas WM, et al.  (1997) Analysis of the yeast genome: identification of new non-coding and small ORF-containing RNAs. Nucleic Acids Res 25(22):4619-25
2006-01-23ncRNA added based on work published by Olivas et al.

Olivas WM, et al.  (1997) Analysis of the yeast genome: identification of new non-coding and small ORF-containing RNAs. Nucleic Acids Res 25(22):4619-25