CEN2 Locus History Help

Sequence Annotation Notes
DateNote
2004-10-12Centromeric DNA elements CDEI, CDEII, and CDEIII were annotated based on Wieland et al. 2001 and Espelin et al. 2003.

Wieland G, et al.  (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60
Espelin CW, et al.  (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68
2011-02-03Two separate single nucleotide substitutions were made in the intergenic region between ARS208 and CEN2. 
New    238082  AGTACTTGCTTTCAGCAGAAAATGAAAAAAAGAACGTTCAAACAGACTGAAAATATAGCT  238141
               |||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||
Old    238084  AGTACTTGCTTTCAGCAGAAAATGAAAAAAAGGACGTTCAAACAGACTGGAAATATAGCT  238143
Dietrich F  (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. ()
Mapping Notes
DateNote
1996-09-21Edition 13: There are three conserved sequence elements in the centromere that are sufficient for mitotic and meiotic segregation. CDEI (8bp) is required for mitotic segregation; although most assays indicate it is dispensable for meiotic chromosome segregation, it is needed for meiosis I plasmid disjunction. CDEII (78-86 bp A-T rich region) is specifically required for meiosis I disjunction. CDEIII (25 bp) is essential for both mitotic and meiotic segregation.

Cherry JM, et al.  (1996) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 13)". Pp. 361-364 in 1996 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America