ARS603.5 Locus History Help


Nomenclature History
Standard Name Reference
ARS603.5 Friedman KL, et al.  (1997) Replication profile of Saccharomyces cerevisiae chromosome VI. Genes Cells 2(11):667-78
Sequence Annotation Notes
DateNote
2001-03-15Coordinates courtesy of Katsuhiro Shirahige - Personal communication
2007-03-08ACS was annotated based on Xu et al. 2006 and Yamashita et al. 1997.

Xu W, et al.  (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276
Yamashita M, et al.  (1997) The efficiency and timing of initiation of replication of multiple replicons of Saccharomyces cerevisiae chromosome VI. Genes Cells 2(11):655-65
2011-02-03Several nucleotides were changed in the intergenic region between ORF CDC4/YFL009W and ARS603.5.
New    118571  ACTTCGTACATTTTATTGAATATAAACTGCAGCTAAACTGCTTGTATGT-TCAATTTTAA  118629
               ||||||||||||||||||| ||||||||||||||||||||| || |||| ||||||||||
Old    118565  ACTTCGTACATTTTATTGAGTATAAACTGCAGCTAAACTGCCTGGATGTGTCAATTTTAA  118624
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()