ARS504 Feature History Help

Sequence Annotation Notes
DateNote
2004-10-19The following ARS elements on Chromosome V were added to SGD based on Tanaka et al. 1996 and Raghuraman et al. 2001: ARS502, ARS503, ARS504, ARS507, ARS508, ARS510, ARS511, ARS512, ARS513, ARS514, ARS515, ARS516, ARS517, ARS518, ARS519, ARS520, ARS521, ARS522, ARS523.

Tanaka S, et al.  (1996) Systematic mapping of autonomously replicating sequences on chromosome V of Saccharomyces cerevisiae using a novel strategy. Yeast 12(2):101-13
Raghuraman MK, et al.  (2001) Replication dynamics of the yeast genome. Science 294(5540):115-21
2011-02-03A single nucleotide substitution was made within ARS504.
New    9121    GTTGGCCTGCCATACTTTAATTGAATAAAAGCTCCGTATATGCTTCTTAAAAATAAGCAA  9180
               ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old    9121    GTTGGCCTGCCATACTTTAATTGAATAAAAGCTCCGTATATGCTTCTGAAAAATAAGCAA  9180
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()