ARS307 Locus History Help


Nomenclature History
Standard Name Reference
ARS307 Newlon CS, et al.  (1993) Analysis of replication origin function on chromosome III of Saccharomyces cerevisiae. Cold Spring Harb Symp Quant Biol 58:415-23
Sequence Annotation Notes
DateNote
1997-07-27Three sequence changes were made to Chromosome III within ARS307 to correct the systematic reference sequence: A single G was inserted after chromosomal coordinate 108796, the G at 108844 was changed to a C, and the A at 109259 was deleted.
New:   108769 TCTCCAGAAACCCTTCAATATAAAAAGGGCAGATGTCCGCTGCGAACCCTTCTCCATTTG 108828
              |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Old:   108769 TCTCCAGAAACCCTTCAATATAAAAAGG-CAGATGTCCGCTGCGAACCCTTCTCCATTTG 108827
New:   108829 GCAATTATTTGAACACCATCACTAAGTCCCTACAACAGAATTTACAAACATGCTTTCATT 108888
              |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Old:   108828 GCAATTATTTGAACACGATCACTAAGTCCCTACAACAGAATTTACAAACATGCTTTCATT 108887

New:   109249 GCTTACAACAT-TGAAAATATATGGGTTTGATAACGAGGTCATTCTTTCGGGAGCCAACC 109307
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old:   109248 GCTTACAACATATGAAAATATATGGGTTTGATAACGAGGTCATTCTTTCGGGAGCCAACC 109307
1998-02-26Three single nucleotide changes were made to the systematic sequence in the region encompassing ARS307. The G at chromosomal coordinate 108792 was deleted, the C at 108840 was changed to G, and an A was inserted after the T at 109254. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   108763 CTCTCCAGAAACCCTTCAATATAAAAAGGGCAGATGTCCGCTGCGAACCCTTCTCCATTT 108822
              ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
New:   108768 CTCTCCAGAAACCCTTCAATATAAAAAGG-CAGATGTCCGCTGCGAACCCTTCTCCATTT 108826
Old:   108823 GGCAATTATTTGAACACCATCACTAAGTCCCTACAACAGAATTTACAAACATGCTTTCAT 108882
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
New:   108827 GGCAATTATTTGAACACGATCACTAAGTCCCTACAACAGAATTTACAAACATGCTTTCAT 108886
Old:   109243 GGCTTACAACAT-TGAAAATATATGGGTTTGATAACGAGGTCATTCTTTCGGGAGCCAAC 109301
              |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
New:   109247 GGCTTACAACATATGAAAATATATGGGTTTGATAACGAGGTCATTCTTTCGGGAGCCAAC 109306