ARS300 Locus History Help


Nomenclature History
Standard Name Reference
ARS300 Newlon CS, et al.  (1993) Analysis of replication origin function on chromosome III of Saccharomyces cerevisiae. Cold Spring Harb Symp Quant Biol 58:415-23
Sequence Annotation Notes
DateNote
2000-09-13A single nucleotide insertion was made in the systematic sequence in the region encompassing overlapping features ARS300, YCLWTy5-1, and YCL076W. A single C was inserted after the T at 1435. This change resulted in the predicted protein encoded by YCL076W being elongated at the N-terminal end by 51 amino acids. Note that coordinates listed are chromosomal coordinates.
Old:    1434 CT-AGAGCAATGCTTCTGAGAACATAATCAATCTATCTAGCCCCAACAATTATAAACAGT 1492
             || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:    1441 CTCAGAGCAATGCTTCTGAGAACATAATCAATCTATCTAGCCCCAACAATTATAAACAGT 1500