ARS213 Feature History Help


Nomenclature History
Other Name(s)Reference
ARSII-390 Nieduszynski CA, et al.  (2007) OriDB: a DNA replication origin database. Nucleic Acids Res 35(Database issue):D40-6
Sequence Annotation Notes
DateNote
2009-05-07The following ARS elements on Chromosome 2 were added to the genome annotation based on Raveendranathan et al. 2006: ARS212, ARS213, and ARS221.

Raveendranathan M, et al.  (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39
2011-02-03A single nucleotide insertion was made within ARS213.
New    389998  ACTGACACTAAAAAAAGGGTCGTACGTCTTACTGGCAGCGCCGAAAAATGTTTCGAAAAT  390057
               ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Old    389993  ACTGACACTAAAAAAAGGGTCGTACGTCTTACTGGCAGCGC-GAAAAATGTTTCGAAAAT  390051
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()