ARS209 Locus History Help


Nomenclature History
Standard Name Reference
ARS209 Wyrick JJ, et al.  (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60
Sequence Annotation Notes
DateNote
2006-03-02This new ARS element ARS209 was added to the genome annotation based on Bouton & Smith 1986 and Wyrick et al. 2001.

Wyrick JJ, et al.  (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60
Bouton AH and Smith MM  (1986) Fine-structure analysis of the DNA sequence requirements for autonomous replication of Saccharomyces cerevisiae plasmids. Mol Cell Biol 6(7):2354-63
2011-02-03Several nucleotide changes were made within ARS209.
New    254452  AAATATCCTTTTTTTTTTCTTTGCATTTGTCTTCTTTCATTTTAAATCTTCATAATCTTC  254511
               |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old    254453  AAATATCCTTTTTTTTTTCTTTGCATTTGTCTTCTTTCATTTGAAATCTTCATAATCTTC  254512
New    254512  CGGAAAAACTAGTGATGCGAAATATTGTAGAGAAAAAGCGCAGGGCATTCCTATACTTAG  254571
               ||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||
Old    254513  CGGAAAAACTAGTGATGCGCAATATTGTAGAGAAAA-GCGCAGGGCATTCCTATACTTAG  254571
New    254572  TAATCACCATCATAACGTATTTTAAAATGAAGAAGCGAACCTCAAAGAATTTTCTATACA  254631
               |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old    254572  TAATCACCATCATAACGTATTTTAAAATGAAGAAGCGAACCTCATAGAATTTTCTATACA  254631
New    254692  TATATTGCAGAAAATGTGCTAGTAATATTGTTCTCTCTGTTGTCAATGGGCTTACAATTG  254751
               |||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||
Old    254692  TATATTGCAGAAAATGTGCTAGTAATAT-G-TCTCTCTGTTGTCAATGGGCTTACAATTG  254749
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()