ARS1531 Feature History Help


Nomenclature History
Other Name(s)Reference
ARS1506.5 Nieduszynski CA, et al.  (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
ARSXV-36 Nieduszynski CA, et al.  (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
Sequence Annotation Notes
DateNote
2006-10-02ARS1531, also known as ARS1506.5, was added to the genome annotation based on Nieduszynski et al. 2006.

Nieduszynski CA, et al.  (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
2011-02-03A single nucleotide substitution was made within ARS1531.
New    35751    TTTTCAAAATCCGCGCAAAATTATAGAATTCATCATATATAATGAAGGAACTGTGTTCCT  35810
                ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Old    35750    TTTTCAAAATCCGCGGAAAATTATAGAATTCATCATATATAATGAAGGAACTGTGTTCCT  35809
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
2011-02-03Four separate single nucleotide substitutions were made in the intergenic region between ARS1531 and ORF FRE7/YOL152W.
New    36001    AAAACTTGAGAATAACATAACCCTTTAATAGGCCAATGCAACTGATAGAACACCAGAAAA  36060
                ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||
Old    36000    AAAACTTGAGAATTACATAACCCTTTAATAGGCCAATGCAACTGATAGAACACCAGGAAA  36059
New    36061    AGTTGTAATGCCAGTGCGGCTGAACAGAATCTGTGGTAATAGATTTCGGGTATAATGCGC  36120
                |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    36060    AGTTGTAATGCCAGTGCGGCTGAACAGAATCTGTGGTAATAGATTTCGGGTATAATGCGG  36119
New    36121    AAATTAGGAATACTCATATGTTCAGATAGAATAAATAATAAAGAGACCTTCAACATAAAA  36180
                ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Old    36120    AAATTAGGAATACTCATATGTTCAGATAGGATAAATAATAAAGAGACCTTCAACATAAAA  36179
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()