ARS110 Locus History Help


Nomenclature History
Standard Name Reference
ARS110 Wyrick JJ, et al.  (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60
Other Name(s)Reference
ARSI-176 Nieduszynski CA, et al.  (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
Sequence Annotation Notes
DateNote
2006-02-28This ARS element ARS110 was added to the genome annotation based on Wyrick et al. 2001 and Dimock et al. 1984.

Dimock K, et al.  (1984) Molecular cloning of the ADE1 gene of Saccharomyces cerevisiae and stability of the transformants. Gene 27(2):233-7
Wyrick JJ, et al.  (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60
2006-09-06Updated coordinates of the following ARS elements on Chromosome I based on Nieduszynski et al. 2006: ARS101/109, ARS110.

Nieduszynski CA, et al.  (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
2011-02-03A single nucleotide deletion and a single nucleotide substitution were made in the intergenic region between ORF YAR019W-A and ARS110.
New    175355  GCCCAATTTTGATTATGCC-TCTTTTCCATACACGACGCCAGAGGACATTATTACATTAC  175413
               ||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||
Old    175352  GCCCAATTTTGATTATGCCTTCTTTTTCATACACGACGCCAGAGGACATTATTACATTAC  175411
Dietrich F  (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. ()