ARS106 Feature History Help


Nomenclature History
Other Name(s)Reference
ARSI-70 Nieduszynski CA, et al.  (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
Sequence Annotation Notes
DateNote
2006-09-06The following ARS elements on Chromosome I were added to SGD based on Nieduszynski et al. 2006: ARS104, ARS106, ARS107.

Nieduszynski CA, et al.  (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
2011-02-03Two separate single nucleotide substitutions were made in the intergenic region between ARS106 and ORF CDC19/YAL038W.
New    70746   GGTTTTCCGACTTTATTTGAGATGACTTGAGATGTGTGTCAATGCTAGTATTTTGGAGAT  70805
               ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old    70747   GGTTTTCCGACTTTATTTGAGATGACTTGAGATGTGTGTCAATGCTACTATTTTGGAGAT  70806
New    70856   TTATTTTTTTTTTGTTAGAATTGATCCAAATGTAAATAAACAATCACAAGGAAAAAAAAA  70915
               ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Old    70857   TTATTTTTTTTTTGTTAAAATTGATCCAAATGTAAATAAACAATCACAAGGAAAAAAAAA  70916
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()