ARS104 Feature History Help


Nomenclature History
Other Name(s)Reference
ARSI-31 Nieduszynski CA, et al.  (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
Sequence Annotation Notes
DateNote
2006-09-06The following ARS elements on Chromosome I were added to SGD based on Nieduszynski et al. 2006: ARS104, ARS106, ARS107.

Nieduszynski CA, et al.  (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
2011-02-03A single nucleotide deletion and a single nucleotide insertion were made in the intergenic region between ORF FLO9/YAL063C and ARS104.
New    28027   GTAAATAAGAAGGAAGAACGTTATGTTATTAATGGACTTTT-AGTGTCATCGAATTTTAT  28085
               ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Old    28028   GTAAATAAGAAGGAAGAACGTTATGTTATTAATGGACTTTTTAGTGTCATCGAATTTTAT  28087
New    28916   AGTAAACAAGAGATACCTAATTTCACAGCCACTTTTTGTTGCGGACACTGACGGGATGTG  28975
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Old    28918   AGTAAACAAGAGATACCTAATTTCACAGCCACTTTT-GTTGCGGACACTGACGGGATGTG  28976
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()