ARS1006 Feature History Help

Sequence Annotation Notes
DateNote
2002-12-16Coordinates courtesy of Dr. Oscar M. Aparicio, University of Southern California.

Wyrick JJ, et al.  (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60
2011-02-03Several nucleotide changes were made within ARS1006.
New    99421   TTGCCTTTGTTTACGAGTATATCGTTAATGTTAACGAATACGCTTAAGCGCAATGATTGA  99480
               |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Old    99415   TTGCCTTTGTTTACGAGTATATCGTTAATGTTAACGAATACGCTTAAGCGCAATCATTGA  99474
New    99481   ATAGTCAAAGATTTTTTTTTTTTAATTTTTTTTTTTTAATTTTTTTTTTTTTTCATAGAA  99540
               |||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||
Old    99475   ATAGTCAAAGATTTTTTTTTTTTAATTTTTTTTTTTTAATTTTTTTTTTTT--CATAGA-  99531
New    99541   CTTTTTATTTAAATAAATCACGTCTATATATGTATCAGTATA--ACGTAAAAAAAAAAAC  99598
               | ||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||
Old    99532   C-TTTTATTTAAATAAATCACGTCTATATATGTATCAGTATATAACGTAAAAAAAAAAAC  99590
New    99599   ACCGTCAGTTAAACAAAACATAAATAAAAAAAAAAAGAAGTGT-CAAATCAA-GTGTCAA  99656
               ||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||
Old    99591   ACCGTCAGTTAAACAAAACATAAATAAAAAAAAAAAGAAGTGTTCAAATCAAAGTGTCAA  99650
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()