ARS814 Feature History Help

Sequence Annotation Notes
DateNote
2009-05-06The following ARS elements on Chromosome 8 were added to the genome annotation based on Raveendranathan et al. 2006: ARS801, ARS806, ARS810, ARS811, ARS814, and ARS815.

Raveendranathan M, et al.  (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39
2011-02-03One single nucleotide was inserted, and two single nucleotides deleted, within the ORF HXT4/YHR092C near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 16 amino acids longer. The two nucleotide deletions also alter the sequence of the overlapping ARS814.
New   287091  CCGAACATCTTCTTGTAAAATGG-TTGATC-ATCATGCATTAGATCATCAGCGTTGTAGT  287148
              ||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||
Old   287093  CCGAACATCTTCTTGTAAAATGGGTTGATCCATCATGCATTAGATCATCAGCGTTGTAGT  287152

New   287149  CAGTACCTCTCTTGTTTGGTGGAACCCAAGAAGGTGATTTCCATGGCAAAACACCTTCTT  287208
              |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Old   287153  CAGTACCTCTCTTGTTTGGTGGAACC-AAGAAGGTGATTTCCATGGCAAAACACCTTCTT  287211
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()