HRA1 Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2006-10-27.
Standard Name Reference
HRA1 Samanta MP, et al.  (2006) Global identification of noncoding RNAs in Saccharomyces cerevisiae by modulating an essential RNA processing pathway. Proc Natl Acad Sci U S A 103(11):4192-7
Sequence Annotation Notes
DateNote
2007-02-06This RNA gene, HRA1, was described by Samanta et al. (2006). Approximate start and stop coordinates, which are accurate to within 25 nucleotides, have been specified for this non-coding RNA. Many thanks to Manoj Samanta for alerting us to this noncoding RNA.

Samanta MP, et al.  (2006) Global identification of noncoding RNAs in Saccharomyces cerevisiae by modulating an essential RNA processing pathway. Proc Natl Acad Sci U S A 103(11):4192-7
2007-05-08Updated coordinates of HRA1 based on Yang & Altman 2007.

Yang L and Altman S  (2007) A noncoding RNA in Saccharomyces cerevisiae is an RNase P substrate. RNA 13(5):682-90
2011-02-03Nucleotides 258-260 of the HRA1 coding sequence were changed from ATC to TCG. As a result, the sequence of this ncRNA was altered without changing the length.
New: 1     TATATAATTCGCGTTCGCATGTGAGTTG 28
           ||||||||   ||||||||||||||||| 
Old: 99555 TATATAATATCCGTTCGCATGTGAGTTG 99582
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
2011-02-03A single nucleotide substitution was made within ncRNA HRA1.
New    99825   TTCAACTTAGTGGCATTAAACAGATTTGGGTTTTCTGGCAAAAAAAGCCAATCACGTGAT  99884
               ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Old    99826   TTCAACTTAGTGGCAATAAACAGATTTGGGTTTTCTGGCAAAAAAAGCCAATCACGTGAT  99885
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()