ARS230 Feature History Help


Nomenclature History
Other Name(s)Reference
ARS201.5 Nieduszynski CA, et al.  (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
ARSII-29 Nieduszynski CA, et al.  (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
Sequence Annotation Notes
DateNote
2006-10-02ARS230 (also known as ARS201.5) and ARS231 (also known as ARS207.5) were added to the genome annotation based on Nieduszynski et al. 2006.

Nieduszynski CA, et al.  (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
2011-02-03A dinucleotide insertion and a mononucleotide insertion were made in the intergenic region between ORF YBL100W-C and ARS230.
New    28859   ATTACTGTTTCGGGAATATAACGTTTGATATCGCTAGCGCACCCAGATGAGAAATCCGCA  28918
               |||||||||||||||||||||||||||||  |||||||||||||||||||||| ||||||
Old    28859   ATTACTGTTTCGGGAATATAACGTTTGAT--CGCTAGCGCACCCAGATGAGAA-TCCGCA  28915
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()