ARS734 Feature History Help


Nomenclature History
Other Name(s)Reference
ARSVII-999 Nieduszynski CA, et al.  (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
Sequence Annotation Notes
DateNote
2006-09-08The following new ARS elements on Chromosome VII were added to SGD based on Nieduszynski et al. 2006: ARS702, ARS704, ARS707, ARS710, ARS714, ARS716, ARS717, ARS718, ARS719, ARS720, ARS721, ARS722, ARS727, ARS728, ARS729, ARS731, ARS733, ARS734.

Nieduszynski CA, et al.  (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
2011-02-03Two separate single nucleotide substitutions and a single nucleotide insertion were made in the intergenic region between ORF PUP2/YGR253C and ARS734.
New    999218   AATTTCCTAGGTTACTCTTTTGCCACCGGTCTTGGTTTATGATAACCCTGTATAATGAAA  999277
                |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old    999223   AATTTCCTAGGTTACTCTTTTGCCACCGGTCTTGGTTTATGATAACCCCGTATAATGAAA  999282
New    999318   AGCACTAAATTATCCTTACGGACTTGGGCTACATTCATGTTTGCACGCTTAATAAAAAAT  999377
                ||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||
Old    999323   AGCACTAAATTAT-CTTACGGACTTGGGCTACATTCATGTTTGCAAGCTTAATAAAAAAT  999381
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
2011-02-03A single nucleotide deletion was made within ARS734.
New    999628   CTGAGCTTTTATCTTCATTAATATATAGTAATTACAACATGTTA-TTGAAATGCACAGCA  999686
                |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old    999632   CTGAGCTTTTATCTTCATTAATATATAGTAATTACAACATGTTATTTGAAATGCACAGCA  999691
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()