ARS805 Locus History Help


Nomenclature History
Standard Name Reference
ARS805 Wyrick JJ, et al.  (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60
Other Name(s)Reference
ARSVIII-64 Nieduszynski CA, et al.  (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
SPO11 ARS Atcheson CL, et al.  (1987) Isolation, DNA sequence, and regulation of a meiosis-specific eukaryotic recombination gene. Proc Natl Acad Sci U S A 84(22):8035-9
Sequence Annotation Notes
DateNote
2006-04-13ARS805, also known as "SPO11 ARS", was added to the genome annotation for Chromosome VIII at coordinates 64155-64459 based on Wyrick et al. 2001 and Atcheson et al. 1987.

Atcheson CL, et al.  (1987) Isolation, DNA sequence, and regulation of a meiosis-specific eukaryotic recombination gene. Proc Natl Acad Sci U S A 84(22):8035-9
Wyrick JJ, et al.  (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60
2006-09-07The coordinates of ARS805 were updated based on Nieduszynski et al. 2006.

Nieduszynski CA, et al.  (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
2011-02-03A single nucleotide insertion was made within ARS805. 
New    64380   AACATTAAAAAAAAAATTGTCACTACACAGAGAGAAAATAAATAAATATAAAGAATCACA  64439
               ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Old    64378   AACATTAAAAAAAAA-TTGTCACTACACAGAGAGAAAATAAATAAATATAAAGAATCACA  64436
Dietrich F  (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. ()