TEL01R-XC Feature History Help

Sequence Annotation Notes
DateNote
2003-09-09The chromosomal locations for the following telomeric features on Chromosome I were generously provided by Ed Louis and Dave Barton (University of Leicester, UK): TEL01L, TEL01L-TR, TEL01L-XC, TEL01L-XR, TEL01R, TEL01R-TR, and TEL01R-XC.
2011-02-03A single nucleotide insertion was made within the right telomere of Chromosome 1, TEL01R, specifically within the X element Core sequence TEL01R-XC.
New    229542  ATTACGCATGGAGTTAAGAGTATTTACATGATAATTGGGGTTCCGTGATTCATTATAGAT  229601
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Old    229533  ATTACGCATGGAGTTAAGAGTATTTACATGATAATT-GGGTTCCGTGATTCATTATAGAT  229591
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()