TEL08L-YP Feature History Help

Sequence Annotation Notes
DateNote
2003-09-09The chromosomal locations for TEL08L, TEL08L-TR, TEL08L-XC, TEL08L-XR, TEL08L-YP, TEL08R, TEL08R-TR1 , TEL08R-TR2, TEL08R-XC, TEL08R-XR, and TEL08R-YP were generously provided by Ed Louis and Dave Barton (University of Leicester, UK).
2011-02-03A single nucleotide insertion was made in the left telomere of chromosome 8, specifically within Y' element TEL08L-YP and the intron of overlapping ORF YHL050C.
New    2221    CTTAATTGGTGGCAATTCACCCTTACGATTCCTTGCGGCCCAACTGTTTTTTCTAGATAA  2280
               ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Old    2221    CTTAATTGGTGGCAATTCACCCTTACGATTC-TTGCGGCCCAACTGTTTTTTCTAGATAA  2279
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()