YCR024C-B Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03Two single nucleotide substitutions were made in the intergenic region between ORFs YCR024C and YCR024C-B.
New  162241  TGTTCTCTTTCTTTCTCTCTTAGTAAGCGATAAGTCGAGCTCTACTTAAATTGTGGTACG  162300
             |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Old  162237  TGTTCTCTTTCTTTCTCTCTTAGTAAGCGATAAGTCGAACTCTACTTAAATTGTGGTACG  162296

New  162361  TAACTATAAGTTGTGCATACTCATACTCCACACTCGACGGCCTAATCTCTGTAAGGATTG  162420
             ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Old  162357  TAACTATAAGTTGTGCATACTCATACTCCACACTCCACGGCCTAATCTCTGTAAGGATTG  162416
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()