RRT15/YLR162W-A Locus History Help


Nomenclature History
Standard Name Reference
RRT15 Hontz RD, et al.  (2009) Genetic Identification of Factors That Modulate Ribosomal DNA Transcription in Saccharomyces cerevisiae. Genetics 182(1):105-19
Sequence Annotation Notes
DateNote
2003-07-29Thanks to Kessler et al. for providing the coordinates of the following Chromosome XII ORFs: YLR285C-A, YLR312C-B, YLR342W-A, YLR412C-A, YLL006W-A, YLR154C-G, YLR154C-H, YLR154W-B, YLR156C-A, YLR157C-C, YLR159C-A, YLR162W-A, and YLR222C-A.

Kessler MM, et al.  (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71
2011-02-03A single nucleotide deletion was made in the intergenic region between ORFs RRT15/YLR162W-A and MAS1/YLR163C.
New    491099   TGAAGAGGTAGGTACATATTCATTGGCAGATATTCTACAATGCAATTATTATGA-CCAATCACACAGTAT  491167
                |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old    491100   TGAAGAGGTAGGTACATATTCATTGGCAGATATTCTACAATGCAATTATTATGACCCAATCACACAGTAT  491169
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()