YGL041C-B Feature History Help

Sequence Annotation Notes
DateNote
2003-07-29Thanks to Kessler et al. for providing the coordinates of the following Chromosome VII ORFs: YGR240C-A, YGL210W-A, YGR121W-A, and YGL041C-B.

Kessler MM, et al.  (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71
2011-02-03A single nucleotide deletion was made in the intergenic region between ORFs YGL042C and YGL041C-B.
New    418594   ATATACATATACTGCTGGTGTTAATTTTTTTTGTC-TGTCTCACGTAAAATCTTTTGTTC  418652
                ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Old    418598   ATATACATATACTGCTGGTGTTAATTTTTTTTGTCCTGTCTCACGTAAAATCTTTTGTTC  418657
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()