ARS310 Locus History Help


Nomenclature History
Standard Name Reference
ARS310 Newlon CS, et al.  (1993) Analysis of replication origin function on chromosome III of Saccharomyces cerevisiae. Cold Spring Harb Symp Quant Biol 58:415-23
Sequence Annotation Notes
DateNote
2000-09-13The systematic sequence was updated in the region encompassing feature ARS310. Note that coordinates listed are chromosomal coordinates.
Old:   166701 CTTAGGTACAAAAAGATTAAGAAAGTCAAATTGTCCTTAGTTTTAAAAGACAGAGTTACT 166760
              ||||||||||||||||||||||||||||| |||||||||||||||||||||||  |||||
New:   166982 CTTAGGTACAAAAAGATTAAGAAAGTCAA-TTGTCCTTAGTTTTAAAAGACAG--TTACT 167038
Old:   166761 TCATGTCTTTAACATCAACAGCAAATTACTTTGAAAAAATGCACTAAAAGTTAACACATG 166820
              ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
New:   167039 TCATGTCTTTAACATCAACGGCAAATTACTTTGAAAAAATGCACTAAAAGTTAACACATG 167098