ARS306 Locus History Help


Nomenclature History
Standard Name Reference
ARS306 Newlon CS, et al.  (1993) Analysis of replication origin function on chromosome III of Saccharomyces cerevisiae. Cold Spring Harb Symp Quant Biol 58:415-23
Sequence Annotation Notes
DateNote
2000-09-13Several sequence changes were made in the systematic sequence in the region upstream of ARS306. Note that coordinates listed are chromosomal coordinates.
Old:   73691 CTCATCCCTTGCTGAAGCAGGCCTCTTTTGACCGGCAGG-CTTTCTATAGCCTTAGTCAC 73749
             ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
New:   73720 CTCATCCCTTGCTGAAGCAGGCCTCTTTTGACCGGCAGGGCTTTCTATAGCCTTAGTCAC 73779
Old:   73930 TTTCAAATAAGTTGCAACCAGCAGACATGATATTGGATTGTTTCTTTGTATATATGTTGA 73989
             |||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||
New:   73960 TTTCAAATAAGTTGCAAC-AGCAGACATGATATTGGATTGTTTTTTTGTATATATGTTGA 74018
Old:   73990 TATAGGATACTTCAGTCTACGAAAAAAGTACAAATTATGTAGTCAGTTCCTTCAGCATGG 74049
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
New:   74019 TATAGGATACTTCAGTCTACGAAAAAAGTACAAATTATGTAGTCAGTTCCTTCAGTATGG 74078
Old:   74170 TTTTTCGAATAATCATTAGTAAAAGCGGTATACTGGATTATTGTACGATAACAAGGTAGA 74229
             ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   74199 TTTCTCGAATAATCATTAGTAAAAGCGGTATACTGGATTATTGTACGATAACAAGGTAGA 74258
Old:   74290 AGAAGGAGAGGGTCTGCTGAATAGTGTGAGCAGTGTTTCTGAACTTTTTCTTCGTCTAAG 74349
             |||||||| ||||||| |||||||||| ||||||||||||||||||||||||||||||||
New:   74319 AGAAGGAGCGGGTCTGGTGAATAGTGTAAGCAGTGTTTCTGAACTTTTTCTTCGTCTAAG 74378
2000-09-13Two sequence changes were made in the systematic sequence in the region encompassing feature ARS306. Note that coordinates listed are chromosomal coordinates.
Old:   74470 TTTTTTTAAATTTTCGAATTGTATTTATATTTATTTAGTACTTCTTGAGTTTACATATCC 74529
             |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   74499 TTTTTTCAAATTTTCGAATTGTATTTATATTTATTTAGTACTTCTTGAGTTTACATATCC 74558
Old:   74530 TTCGTAAAAATGCAACTTCTGTCGAAAAACACTTCCAAAAAAAAATAATAATGAATTTAT 74589
             |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
New:   74559 TTCGTAAAAATGCAACTTTTGTCGAAAAACACTTCCAAAAAAAAATAATAATGAATTTAT 74618