ARS305 Locus History Help


Nomenclature History
Standard Name Reference
ARS305 Newlon CS, et al.  (1993) Analysis of replication origin function on chromosome III of Saccharomyces cerevisiae. Cold Spring Harb Symp Quant Biol 58:415-23
Sequence Annotation Notes
DateNote
2000-09-13One sequence substitution was made in the systematic sequence in the intergenic region between features YCL050C and ARS305. The T at 39099 was changed to A. Note that coordinates listed are chromosomal coordinates.
Old:   39090 GTTATGGGATTATCGTGTAAGCTGGGGTGACTTTTGAGCTATTCGCGACGCCCGACGCCG 39149
             ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
New:   39114 GTTATGGGAATATCGTGTAAGCTGGGGTGACTTTTGAGCTATTCGCGACGCCCGACGCCG 39173
2000-09-13Several sequence changes were made in the systematic sequence in the region encompassing feature ARS305. Note that coordinates listed are chromosomal coordinates.
Old:   39210 ATGTTAACAAACAGTTCTGATTATTCGCCTTCTGACAGGACGATAATGTAAATAGTTGTG 39269
             ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
New:   39234 ATGTTAACAAACAGTTCTGATTATTCGCCTTTTGACAGGACGATAATGTAAATAGTTGTG 39293
Old:   39270 GTAGTATCATTCAGGTATGTAACTGTTTACTTGGTATCGCTTGAAAAAAATAAGCATTTC 39329
             |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
New:   39294 GTAGTATCATTCAGGTATGTAACTGTTTACTTTGTATCGCTTGAAAAAAATAAGCATTTC 39353
Old:   39450 TATTATTTTTTATTTACTTTGTAGTTCTTAAAGCTAAGGTTTTTTTCTTTCCTAAATTCT 39509
             |||||||||||||||||||||||||||||||||||||| |||||||||||  ||||||||
New:   39474 TATTATTTTTTATTTACTTTGTAGTTCTTAAAGCTAAGATTTTTTTCTTTGATAAATTCT 39533
Old:   39510 TGTTTAAATATCCTAAAACTAAAGGGAAAATAAACAATACATAACAAAACATATAAAAAC 39569
             |||||  ||||||||||| |||||||||||||||||||||||||||||||||||||||||
New:   39534 TGTTTTCATATCCTAAAATTAAAGGGAAAATAAACAATACATAACAAAACATATAAAAAC 39593
Old:   39570 CAACACAATAAAAGAAAGGATCAAATACTCATTAAAGTAACTTACACGGGGGGCTAAAAA 39629
             ||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||
New:   39594 CAACACAATAAAAAAAAGGATCAAATACTCATTAAAGTAACTTACACGGGGG-CTAAAAA 39652