ARS304 Locus History Help


Nomenclature History
Standard Name Reference
ARS304 Newlon CS, et al.  (1993) Analysis of replication origin function on chromosome III of Saccharomyces cerevisiae. Cold Spring Harb Symp Quant Biol 58:415-23
Sequence Annotation Notes
DateNote
2000-09-13A dinucleotide substitution was made in the systematic sequence in the region encompassing feature ARS304. The GT at 30504-5 was changed to TG. Note that coordinates listed are chromosomal coordinates.
Old:   30470 AAATCTCAAAGTCGAAGAAACACAGAACACAGAAGTAAACTGGACTAAATGATTTTCAAT 30529
             ||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||
New:   30487 AAATCTCAAAGTCGAAGAAACACAGAACACAGAATGAAACTGGACTAAATGATTTTCAAT 30546